DNA Promoter Methylation and ERG Regulate the Expression of CD24 in Prostate Cancer

CD24 is overexpressed in many human cancers and a driver of tumor progression. Herein, molecular mechanisms leading to up-regulation prostate cancer were studied. DNA methylation the gene promoter at four loci using quantitative methylation-specific PCR was evaluated. Expression tissues studied by immunohistochemistry. To corroborate results vitro, ERG-inducible LNCaP TMPRSS2:ERG (T2E) cells luciferase assays used. significantly higher tumors than benign tissue associated with biochemical recurrence–free survival, grade, stage. mRNA protein expression T2E-positive, ERG-overexpressing, and/or PTEN-deficient cases. Higher levels conferred shorter these observations confirmed The Cancer Genome Atlas adenocarcinoma data. In silico analysis revealed an ERG binding site between sites. overexpression led strong induction expression. Luciferase wild-type mutated within showed ERG-dependent activation. Collectively, our suggest that T2E fusion status are factors involved patients cancer. types, including (PCa).1Gorges T.M. Kuske A. Rock K. Mauermann O. Muller V. Peine S. Verpoort Novosadova Kubista M. Riethdorf Pantel Accession heterogeneity multiplex transcriptome profiling single circulating cells.Clin Chem. 2016; 62: 1504-1515Crossref PubMed Scopus (97) Google Scholar, 2Ding G. Yu Cheng Li Y. Androgen receptor (AR) promotes male bladder cell proliferation migration via regulating VEGF.Am J Trans Res. 8: 578-587PubMed 3Deshmukh Kumar Arfuso F. Newsholme P. Dharmarajan Secreted Frizzled-related 4 (sFRP4) chemo-sensitizes stem derived from breast, prostate, ovary lines.Sci Rep. 2017; 7: 2256Crossref (24) 4Zhang B. Zhang X. Sonpavde G.P. Jiao Sun Chu C. Wang L. Cui R. Liu genetic modifier for risk progression cancer.Mol Carcinogen. 56: 641-650Crossref (13) 5Duex J.E. Owens Chauca-Diaz Dancik G.M. Vanderlinden L.A. Ghosh D. Leivo M.Z. Hansel D.E. Theodorescu Nuclear drives growth predictive poor patient prognosis.Cancer 77: 4858-4867Crossref (12) 6Kristiansen Pilarsky Pervan J. Sturzebecher Stephan Jung Loening Rosenthal Dietel significant predictor PSA relapse prognosis low grade or organ confined cancer.Prostate. 2004; 58: 183-192Crossref (123) 7Weichert W. Denkert Burkhardt Gansukh T. Bellach Altevogt Kristiansen Cytoplasmic colorectal independently correlates shortened survival.Clin 2005; 11: 6574-6581Crossref (140) Scholar This molecule has oncogenic properties features, growth, dissemination, metastatic progression, immune evasion suppression macrophages.5Duex Scholar,8Shakiba N. White C.A. Lipsitz Y.Y. Yachie-Kinoshita Tonge P.D. Hussein S.M.I. Puri M.C. Elbaz Morrissey-Scoot Munoz Benevento Rogers I.M. Hanna J.H. Heck A.J.R. Wollscheid Nagy Zandstra P.W. tracks divergent pluripotent states mouse cells.Nat Commun. 2015; 6: 7329Crossref (46) 9Nguyen D.X. Bos Massague Metastasis: dissemination organ-specific colonization.Nat Rev Cancer. 2009; 9: 274-284Crossref (1830) 10Lee Kim S.H. Lee E.S. Y.S. development progression: meta-analysis.Oncol 22: 1149-1156PubMed 11Thomas Harding M.A. Smith S.C. Overdevest J.B. Nitz M.D. Frierson H.F. Tomlins S.A. effector HIF-1-driven primary metastasis.Cancer 2012; 72: 5600-5612Crossref (91) 12Bretz Noske Keller Erbe-Hofmann Schlange Salnikov A.V. Moldenhauer invasion suppressing factor pathway inhibitor-2 (TFPI-2) c-Src-dependent fashion.Clin Exp Meta. 29: 27-38Crossref (43) 13Barkal A.A. Brewer R.E. Markovic Kowarsky Barkal Zaro B.W. Krishnan Hatakeyama Dorigo L.J. Weissman I.L. signalling through macrophage Siglec-10 target immunotherapy.Nature. 2019; 572: 392-396Crossref (303) A recent meta-analysis 29 studies involving different types more frequently carcinomas their counterparts strongly advanced stages worse survival.10Lee line seminal study on PCa, several other have consistently demonstrated compared normal prostatic hyperplasia negative association survival.4Zhang Scholar,6Kristiansen Scholar,14Kristiansen Sammar Tumour biological aspects CD24, mucin-like adhesion molecule.J Mol Histol. 35: 255-262Crossref (233) 15Kristiansen Wissmann Kaiser Bruemmendorf Roepcke Dahl E. Hinzmann Specht microdissected matched samples reveals CD166/MEMD as new prognostic markers survival.J Pathol. 205: 359-376Crossref (145) 16Zhang Yi Chen Bae Wei Guo R.J. Lu Nguyen L.L. Yang W.H. Lillard J.W. Silencing enhances PRIMA-1-induced restoration mutant p53 2545-2554Crossref (23) 17Schostak Krause H. Miller Schrader Weikert Christoph Kempkensteffen Kollermann Quantitative real-time RT-PCR detection cancer.BMC Urol. 2006; 7Crossref (22) Furthermore, suggested use novel therapy (for review, see et al18Altevogt Huser Novel insights into function CD24: driving force cancer.Int 2020; 148: 546-559Crossref (21) Scholar). regulation particularly epigenetic level, still poorly understood. first evaluate putative delineate whether this mechanism could play role activation PCa. region clinically annotated PCa analyzed investigate associations outcomes. addition, specimens, fusion-positive (ERG-overexpressing) cases observed. Using cells, demonstrates required data establish correlate specific subtypes survival. cohort used test differences tissue, hyperplasia, cancerous region. included (n = 35) well 28) hormone therapy-naïve treated prostatectomy 30), representing wide range pathologic grades. All underwent surgery Department Urology, University Hospital Bonn (Bonn, Germany), diagnosed Institute Pathology, Bonn. An independent 274) verification immunohistochemistry analysis. radical Bonn, (years 2000 2008). Median follow-up time 63 (range, 1 145) months. Clinicopathologic characteristics outlined Table 1.Table 1Clinicopathologic Characteristics Study Cohort 274)ParameterAbsoluteProportion, %Age, median (range), years64.2 (45–83)pT category pT218868.6 pT38229.9 pT441.5WHO/ISUP group Group 115355.8 25018.2 3217.7 43512.8 5155.5pN category∗Often limited minimal lymph node dissection. N025693.4 N+176.2 Nx10.4R R017965.3 R19133.2 Missing41.5Availability methylation274100 immunohistochemistry17965.3 Survival data24990.9ISUP, International Society Urologic Pathologists; WHO, World Health Organization.∗ Often Open table tab ISUP, Organization. approved ethics committee (vote number 071/14). Ethics waived necessity signed informed consent. Formalin-fixed, paraffin-embedded archival specimens extract analyses. gross dissected scalpel five consecutive sections (20 μm thick) block section (5 formalin-fixed, stained hematoxylin eosin histologic control mapping content. Tissue microarrays constructed maximal (range 5) cores per patient, each mm diameter, arranged paraffin blocks. Histologic content performed experienced pathologist (G.K.). Bisulfite-converted prepared innuCONVERT Bisulfite All-In-One Kit (Analytik Jena AG, Jena, Germany) following manufacturer's instructions. PCRs targeting buffer conditions, previously described ACTB reference gene.19Goltz Gevensleben Dietrich Ellinger Landsberg Promoter checkpoint PD-1 (PDCD1) biomarker recurrence-free survival prostatectomy.Oncoimmunology. 5: e1221555Crossref (40) primers probes applied presented 2. Each sample measured triplicate 20 ng bisulfite-converted every reaction. calculation percentage formula: Δ cycle threshold (CT) CTCD24 – CTACTB, ΔΔCT ΔCTSample ΔCTCalibrator, Methylation(%) 100% ∗ 2ΔΔCT.Table 2Primer Probe SequencesPrimer/probeSequenceAnnealing temperature, °CMethylation assay qPCR ACTB-F5′-CCCTTAAAAATTACAAAAACCACAA-3′51.0 ACTB-R5′-GGAGGAGGTTTAGTAAGTTTTTTG-3′51.9 ACTB-probe647N-ACCACCACCCAACACACAATAACAAACACA-BHQ-262.3 CD24-A-F5′-TTGGCGGTTTTATTATAATTTATCGT-3′51.6 CD24-A-R5′-CCTTTATCTCGAACGATTCTACTC-3′52.7 CD24-A-probeTTCGGTTTTTGTTGTTCGTTATTCGTTT61.0 CD24-B-F5′-TACTTAAAAAACCGCTAACTCCG-3′53.1 CD24-B-R5′-GTTTTTTTGGTATATAAGGTTTCGTC-3′54.4 CD24-B-probeFAM-ACGCAAACAAAATAAAAAACGCGA-BHQ-259.0 CD24-C-F5′-TATTGTTTTGTTTATGTTTTTTTCGTC-3′50.3 CD24-C-R5′-CCGAAACCAACGATTCTCCAAA-3′55.7 CD24-C-probeFAM-TGCGCGGCGCGTTTAGTAGGAT-BHQ-264.0 CD24-D-F5′-TTACTTTATTCTATAAACGCCTCG-3′50.7 CD24-D-R5′-AGTTTTTGGGAAGATGCGGATTC -3′55.9 CD24-D-probeFAM-AACGCAATAAACTCACGAAAACGTCC-BHQ-260.0qPCR GAPDH-F5′-AGCCACATCGCTCAGACAC-3′58.8 GAPDH-R5′-GCCCAATACGACCAAATCC-3′56.7 CD24-F5′-TGGATTTGACATTGCATTTGA-3′52.0 CD24-R5′-TGGGGGTAGATTCTCATTCATC-3′58.4Cloning Neg_ctrl-F5′-ACCTCAGCTACGAGTGGTCT -3′57.0 Neg_ctrl -R5′-GTGAGCGTAAAGGGACAAAACT Pos_ctrl-F5′-CAAAAGACCAGGACCAGATAAC-3′53.5 Pos_ctrl-R5′-CCACAGACAAAAAAGGACGAG-3′54.4 CD24_prom-F∗Resulting amplicon depicted Supplemental Figure S2.5′-ACTAGGTTTGGTCTCTGCTGT-3′55.5 CD24_prom-R∗Resulting S2.5′-CCCCCAAAAGAAAAGTCCGC-3′56.8 CD24_mut-R∗Resulting S2.5′-CGCAGGCGGTGAGAGGGTCCGGA-3′68.9ACTB, beta-actin; BHQ, black hole quencher; F, forward; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; qPCR, PCR; R, reverse.∗ Resulting S2. ACTB, reverse. microarray blocks cut (3 mounted superfrost slides (Menzel Gläser, Brunswick, Germany). After deparaffinization xylene gradual rehydration, antigen retrieval achieved pressure cooking 0.01 mmol/L citrate 5 minutes. Slides incubated antibody (monoclonal CD24; clone SWA1120Jackson Waibel Weber Bell Stahel R.A. signal-transducing expressed B major surface small lung carcinomas.Cancer 1992; 52: 5264-5270PubMed Scholar; dilution 1:1), counterstained hematoxylin, aqueous medium. immunohistochemical staining evaluated separately membrane cytoplasm four-tiered scoring system (0 indicates negative; 1, weakly positive; 2, moderately 3, positive) core. intensity analyses case patient. (TCGA) (version 28.01.2016) consisted n 497 prostatectomy, 382 whom had complete clinicopathologic data, 333 who information related recurrent alterations (eg, ERG, PTEN, SPOP) corresponding whole exome sequencing samples.21Cancer Research NetworkThe taxonomy cancer.Cell. 163: 1011-1025Abstract Full Text PDF (1593) For analysis, normalized generated Illumina HiSeq RNA Sequencing platform version 2 (Illumina, San Diego, CA) not available TCGA cohort. purchased ATCC (Manassas, VA). Stably T2E-expressing established previously22Ratz Laible Kacprzyk Wittig-Blaich S.M. Tolstov Duensing Klauck Sultmann variants induce TGF-beta signaling epithelial mesenchymal transition cells.Oncotarget. 25115-25130Crossref cultured RPMI 1640 medium (Thermo Fisher Scientific, Waltham, MA) supplemented 10% tetracycline-controlled transcription–system fetal bovine serum (Clontech Laboratories/Takara Bio, Mountain View, 80 μg/mL hygromycin Scientific). Overexpression transgene III VI induced 50 ng/μL doxycycline (Sigma-Aldrich, St. Louis, MO) transcription–fetal serum. Gene HT-12 arrays (http://www.ncbi.nlm.nih.gov/geo; accession GSE78032).22Ratz harvested 72 hours after induction, isolated RNeasy Mini (Qiagen, Hilden, Total transcribed according RevertAid First Strand cDNA Synthesis Scientific) instructions oligo dT primers. LightCycler 480 instrument (Roche, Basel, Switzerland) technical triplicates. reaction 5.5 μL twofold SYBRGreen Mastermix (Roche), 0.1 μmol/L primer mix, cDNA, 0.4 H2O. Primers listed GAPDH 2−ΔΔCt method.23Livak K.J. Schmittgen T.D. Analysis relative 2(-Delta Delta C(T)) Method.Methods. 2001; 25: 402-408Crossref (111563) Whole lysates radioimmunoprecipitation 1× protease phosphatase inhibitors (cOmplete Mini, PhosStop; Roche Diagnostics, Rotkreuz, Switzerland). Cell debris separated centrifugation, amount quantified Pierce BCA Protein-Assay lane 4% 20% Mini-Protean Precast Protein gel (Bio-Rad Laboratories, Hercules, loaded 25 μg lysate ROTI load (Sigma-Aldrich). transfer proteins, polyvinylidene difluoride Laboratories) blocked 5% albumin phosphate-buffered saline (PBS) + 0.1% Tween hour overnight [glyceraldehyde-3-phosphate dehydrogenase: 14C10 (Cell Signalling Technology, Danvers, MA); ERG: ab92513 (Abcam, Cambridge, UK); dilution: 1:1000] antibody, SWA11; 1:1). Blots washed PBS horseradish peroxidase–coupled secondary [anti-rabbit, 7074 (New England Biolabs, Ipswich, anti-mouse, 7606 Biolabs); 1:10,000]. incubation West Dura chemiluminescence substrate Scientific), proteins visualized ChemiDoc XRS Laboratories). method Bordier.24Bordier Phase separation integral Triton X-114 solution.J Biol 1981; 256: 1604-1607Abstract Briefly, lysed 1% 10 Tris/HCl, pH 7.4, 4°C, centrifugation. cleared overlayed sucrose cushion, shifted 30°C allow phase separation, then centrifuged separate detergent phases. top cushion harvested, 0.5% second round separation. Finally, phases collected Western blot Cells fixed formaldehyde PBS. repeated washing, X-100 added minutes permeabilize cells. 3× albumin, 22.5 g/L glycine Tween. Primary diluted 4°C (ERG ab92513, 1:250; SWA11, fluorophore-conjugated [anti-rabbit; ab98462 (Abcam); anti-mouse; sc-516178 (Santa Cruz Biotechnology, Dallas, TX); 1:1000]. DAPI, mountant overnight. Desired images taken ZEISS Observer (Carl Zeiss × 106 cells/mL fluorescence-activated sorting (PBS, serum, sodium azide). suspension (100 μL) 30 3 [mouse IgG, G3A1 Technology); 1:1] albumin/PBS. fluorochrome-conjugated [ab150113 1:2000]. permeabilized samples, same antibodies concentrations applied. Fixation permeabilization FIX & PERM Permeabilization stored dark until measurement analyzer (BD Biosciences, Jose, CA). antibody-only served control. Publicly chromatin immunoprecipitation–sequencing (ChIP-Seq) FASTQ files cells25Sandoval G.J. Pulice J.L. Pakula Schenone Takeda D.Y. Pop Boulay Williamson K.E. McBride M.J. Pan St Pierre Hartman Garraway Carr Rivera M.N. Z. Ronco Hahn W.C. Kadoch Binding TMPRSS2-ERG BAF remodeling complexes mediates oncogenesis.Mol Cell. 2018; 71: 554-566.e7Abstract (38) filtered quality (cutoff, 90%). Alignment genome (hg38) facilitated Bowtie2 2.2.6 (http://bowtie-bio.sourceforge.net; default settings).26Langmead Trapnell Salzberg S.L. Ultrafast memory-efficient alignment short sequences genome.Genome Biol. 10: R25Crossref (13977) One paired-end reads trimmed bp, duplicates removed samtools 1.2 (Genome Limited, Hinxton, UK; http://www.htslib.org). Peak calling MACS2 2.1.1.20 (https://pypi.org/project/MACS2; settings) Q ≤ 0.05. ERG-ChIP-Seq signals Integrative Genomics Viewer browser control,25Sandoval where no signal approximately 1000-bp fragment genomic amplified cloned pGL4.10[luc2] vector. site, discovered ChIP-Seq examined ERG-binding motifs JASPAR.27Fornes Castro-Mondragon J.A. Khan van der Richmond P.A. Modi B.P. Correard Gheorghe Baranasic Santana-Garcia Tan Cheneby Ballester Parcy Sandelin Lenhard Wasserman W.W. Mathelier JASPAR 2020: update open-access database transcription profiles.Nucleic Acids 48: D87-D92PubMed addition construct, fragment. HLA-DMB chosen positive control, because shows highest correlation RNA-Seq peaks (LNCaP25Sandoval Scholar) present promoter. As broad desert chromosome 9, regulatory elements motifs, chosen. Cloning seeded 96-well plates, ng/mL 24 hours, vectors (pGL4.10:pGL4.74; 10:1) transfected JetPEI transfection reagent (Polyplus-transfection, Illkirch, France), additional 48 incubation, activity Dual-Glo Assay System (Promega, Madison, WI), producer's protocol, Infinite M200 microplate reader (Tecan, Männedorf, experiment pGL4.10 firefly internal pGL4.74 renilla signals. Statistical R 3.4.1 (R Foundation Computing, Vienna, Austria). U-tests comparison methylation, mRNA, groups. Correlation Spearman Pearson tests. χ2 compare membranous status. Kaplan-Meier estimates log-rank test, univariate multivariate Cox regression developmental (Figure 1A). Among selected, only C D difference (normal BPH) malignant (PCa) 1B). detected all <0.6%, mirroring differential/heterogeneous broader CpG island. cohort, therefore some